Comparison of magnetic bead and rapid swab RNA extraction methods for detecting rabbit hemorrhagic disease virus 2 in rabbit liver samples

To find sensitive RNA and DNA extraction methods that could be implemented in the field, we compared a laboratory-based magnetic bead extraction method with a single-step, one-tube extraction method that required only a heat block and ice for cooling the sample after extraction. The methods were evaluated using liver tissue samples obtained from rabbits that were submitted to the US Geological Survey National Wildlife Health Center in 2020 and subsequently confirmed to harbor rabbit hemorrhagic disease virus 2 (RHDV2).

Briefly, nine rabbit liver tissue samples (previously stored frozen at -80°C and thawed on ice) were homogenized in a 1:10 w/v dilution in virus transport medium. Virus transport medium contains Hanks’ balanced salt solution, 0.035% sodium bicarbonate, 0.05% glycerol, 0.05% gelatin, 1 μg/ml amphotericin B, 1500 U/ml penicillin, 1500 μg/ml streptomycin and 100 μg/ml gentamicin. RNA was extracted from 50 μl of homogenized sample using a magnetic bead-based extraction method (Ambion MagMAX™ 1836, Thermo Fisher Scientific, MA, USA) on the KingFisher™ Flex System (Thermo Fisher Scientific), with sample RNA eluted in a volume of 90 μl. RT-PCR for RHDV2 was conducted using forward primer TGGAACTTGGCTTGAGTGTTGA, reverse primer ACAAGCGTGCTTGTGGACGG and probe 5′-FAM- TGTCAGAACTTGTTGACATCCGCCC [1]. As recommended by the National Animal Health Laboratory Network, the RHDV2 probe used in this study was labeled with Iowa Black^® FQ-3′ with an internal ZEN modification. RT-PCR was conducted using the TaqMan^® Fast Virus 1-Step Master Mix on the Applied Biosystems QuantStudio™ 5 PCR Platform (Thermo Fisher Scientific). Final primer concentrations were 1 μM each, and final probe concentration was 0.2 μM. Cycling conditions were as follows: 50°C for 5 min, 95°C for 20 s, 95°C for 3 s and 60°C for 30 s, with the last two steps repeated for a total of 45 cycles. A gBlock of RHDV2 (IDT DNA, IA, USA) resuspended to 6 × 10⁹ copies of target DNA (GenBank accession no. NC_878681, bp 6689–7185) was used as a positive amplification control, and negative controls (dH₂0) included an extraction control and master mix set-up control. Using the RT-PCR assay, a tenfold dilution series of the gBlock, ranging from 1 × 10⁶ to 1 × 10¹ copies of target, resulted in a calculated efficiency of 101.2%.

Extraction of RNA from the same nine rabbit liver tissue samples described above was repeated using a rapid extraction method (SwiftX™ Swabs, Xpedite Diagnostics GmbH, Munich, Germany). After thawing on ice, the surface of each rabbit liver tissue sample was swabbed with a cotton-tipped applicator, and any additional liquid in the sample bag was absorbed onto the swab. Each swab was placed into a screw-capped tube in 1.5 ml of the complete rapid extraction medium, heated on a heat block at 90°C for 15 min, then placed on ice until amplification. Swabs from two additional liver samples previously found to be negative for RHDV2 virus were similarly processed. RNA was amplified using the same protocol as described above. RHDV2 RNA was detected in all nine liver samples that were positive for the virus on the first test date and was not detected in the RHDV2-negative swab samples. Cycle threshold (Ct) values were all higher in the RT-PCR following rapid extraction as compared with the magnetic bead extraction method and ranged from 1.26 to 7.72 units higher (mean: 3.79). The Ct values for the positive amplification control for each RT-PCR were similar in both RT-PCR runs (27.52 and 27.46, respectively). Based on the calculation that each cycle of PCR doubles the amplicon concentration, and assuming that a 3.3-unit difference in Ct represents 1 log₁₀ difference in concentration [2], the second extraction method resulted in an approximately tenfold reduction in sensitivity. A second freeze–thaw for the samples and less tissue extracted using the rapid extraction may have additionally contributed to the loss in sensitivity.

According to the manufacturer, the rapid extraction reagent is a multicomponent solution that stabilizes viral particles prior to lysis and stabilizes the lysed particles from degradation by other components of the sample. Because the rapid extraction method requires only a single 90°C incubation followed by cooling, and no centrifugation, the method may be well suited for field-based applications. In further support of field use, battery-powered heat blocks and ruggedized nucleic acid amplification instruments, particularly those for isothermal amplification, are becoming more available for field use. While possible drawbacks to using rapid extraction reagent include reduced sensitivity compared with laboratory-based methods and a limited (5-day) shelf life at 2–8°C following reconstitution of the reagent, its ease of use may outweigh these limitations.

Any use of trade, firm or product names is for descriptive purposes only and does not imply endorsement by the US Government.