ReviewOpen Access cc icon

A review on bacterial resistance to carbapenems: epidemiology, detection and treatment options

Ann A Elshamy

Khaled M Aboshanab

Ann A Elshamy

Department of Microbiology & Immunology, Faculty of Pharmacy, Ain Shams University, POB 11566, Cairo, Egypt

Search for more papers by this author

Khaled M Aboshanab

*Author for correspondence: Tel.: +20 010 0758 2620; Fax: +20 224 051 107;

E-mail Address: aboshanab2012@pharma.asu.edu.eg

https://orcid.org/0000-0002-7608-850X

Department of Microbiology & Immunology, Faculty of Pharmacy, Ain Shams University, POB 11566, Cairo, Egypt

Search for more papers by this author

Published Online:27 Jan 2020https://doi.org/10.2144/fsoa-2019-0098

Abstract

Carbapenems are a class of antimicrobial agents reserved for infections caused by multidrug-resistant microorganisms. The emergence of carbapenem resistance has become a serious public health threat. This type of antimicrobial resistance is spreading at an alarming rate, resulting in major outbreaks and treatment failure of community-acquired and nosocomial infections caused by the clinically relevant carbapenem-producing Enterobacteriaceae or carbapenem-resistant Enterobacteriaceae. This review is focused on carbapenem resistance, including mechanisms of resistance, history and epidemiology, phenotypic and genotypic detection in the clinically relevant bacterial pathogens and the possible treatment options available.

Lay abstract

Carbapenems are antimicrobial drugs used for treating infections caused by bacteria that are resistant to multiple antibiotics. In recent years, the rise of carbapenem resistance has become a serious public health threat. Carbapenem resistance is spreading rapidly, causing several outbreaks and treatment failure of many infections. This review focuses on bacterial resistance to carbapenems, including mechanisms of resistance, the history and spread of such resistance, how to detect carbapenem resistance in bacteria causing infections. It also discusses the possible options for treatment.

Keywords:

The emergence & spread of antimicrobial resistance

The risk of antimicrobial resistance (AMR) is rapidly increasing worldwide [1]. Governments all over the globe are starting to pay attention to such a serious threat to modern medicine. The emergence of AMR is a natural phenomenon in microorganisms, yet it is augmented by the overuse of antimicrobial agents in both humans and animals [2,3]. Although antimicrobials are among the most commonly used agents in modern medicine, approximately 50% of prescribed antimicrobials are considered unnecessary. This overuse of antimicrobials is a major driving force toward AMR [4]. The scarcity of new antimicrobials to replace those that have become ineffective necessitates our need to protect the effectiveness of existing agents [2,3]. Some bacteria are intrinsically resistant to more than one class of antimicrobial agents. Cases of acquired resistance are of greater concern; where previously susceptible bacteria acquire resistance to an antimicrobial agent under the selective pressure of use of such agent. Resistance that develops due to chromosomal mutation is termed vertical evolution, while that gained through the acquisition of genetic material from other resistant organisms is termed horizontal evolution [5].

A major reason for the rapid spread of AMR through bacterial populations is that genes conferring resistance are carried on plasmids or on other highly movable genetic elements that are independently replicated and passed between bacterial cells and species. Once a newly discovered antimicrobial agent is proven to be effective and is approved for therapeutic use, clinically significant resistance often appears in months to years [6].

The two most commonly used systems for antimicrobial susceptibility testing worldwide are the Clinical and Laboratory Standards Institute (CLSI) and the European Committee for Antimicrobial Susceptibility Testing [3].

The discovery of carbapenems

Carbapenems are β-lactam antibiotics possessing a β-lactam ring and a five-membered ring which differs from that of penicillin in being unsaturated and having a carbon atom rather than sulfur (Figure 1) [7,8].

Figure 1. **Carbapenem backbone structure.**

This unique molecular structure confers remarkable stability against the majority of β-lactamases, including extended spectrum β-lactamases (ESBLs) [9,10]. In 1976, thienamycin, a naturally derived product of Streptomyces cattleya, was the first discovered carbapenem (Figure 2) [11,12].

Figure 2. **The chemical structure of thienamycin.**

Thienamycin's instability in water limited its clinical use [13]. However, this instability was overcome by the semisynthetic production of its N-formimidoyl derivative, called imipenem (Figure 3) [14,15]. Imipenem is degraded by a renal tubular dipeptidase enzyme, dehydropeptidase I. For this reason, imipenem is co-administered with cilastatin, a competitive antagonist, which inhibits imipenem’s renal degradation [16]. Cilastatin also protects the kidneys from the toxic effects caused by higher doses of imipenem [15–17].

Figure 3. **Chemical structure of imipenem.**

Currently marketed carbapenems, their spectrum of activity & indications

Carbapenems such as imipenem/cilastatin, meropenem, doripenem and ertapenem are the latest developed β-lactams currently available in the market possessing a broad spectrum of activity and are usually reserved for treating infections caused by multidrug-resistant (MDR) pathogens [13,18–20]. Imipenem/cilastatin is used for the treatment of a wide variety of infections, including urinary tract infections and lower respiratory tract infections, especially in cases of infections caused by cephalosporin-resistant bacteria. Meropenem does not need to be administered with cilastatin, as it is not sensitive to the dehydropeptidase I enzyme. Compared with imipenem, meropenem is less active against Gram-positive bacteria (especially Enterococcus) and more active against Gram-negative bacteria. The pyrrolidinyl substituent at the 2-position of meropenem’s side chain (Figure 4) is thought to be responsible for the improved activity against Gram-negative bacteria and stability toward the dehydropeptidase I enzyme [17,21].

Figure 4. **Chemical structure of meropenem.**

Doripenem's spectrum of activity is similar to that of meropenem, with better activity against some resistant Pseudomonas strains. Ertapenem (Figure 5) has lower activity against Pseudomonas aeruginosa, Enterococcus and species of Acinetobacter than imipenem and meropenem but has a longer half-life which allows once-daily dosing. Ertapenem shows good activity against Enterobacteriaceae and anaerobes [7] and is considered one of the first-line treatment options for the empiric treatment of community-acquired intra-abdominal infections, as recommended by the Infectious Disease Society of America (VA, USA) [22, 23]. Doripenem, imipenem and meropenem are recommended for high-risk nosocomial and community-acquired abdominal infections [22].

Figure 5. **Chemical structure of ertapenem.**

Mechanism of action of carbapenems

Bacterial cell walls are complex structures composed of a peptidoglycan polymer. The last transpeptidation step in the synthesis of peptidoglycan is enabled by transpeptidase enzymes, which are penicillin-binding proteins (PBPs). The structure of carbapenems (and other β-lactams) is closely related to acylated D-alanyl-D-alanine – the terminal amino acid residues of the peptidoglycan. This structural similarity allows carbapenems to bind irreversibly to the active site of the PBPs, leading to the inhibition of transpeptidation of the peptidoglycan layer via crosslinking, this in turn disrupts the cell wall synthesis [24,25]. At last, bacterial cell death results from the continued activity of autolysins, a group of bacterial surface enzymes. It is speculated that the biological role of autolysins is to create nicks in the cell wall that function as attachment points for new peptidoglycan units. Thus, inhibition of cell wall biosynthesis by β-lactam agents, in association with continued cell wall autolysis, creates weak spots in the cell wall through which the cell membrane extrudes. Since the cell membrane is not strong enough to keep the hypertonic cell from rupturing by osmotic shock, it eventually ruptures [26,27].

Adverse reactions to carbapenems

The most common adverse reactions to carbapenems are nausea and vomiting, occurring in approximately 1–20% of treated patients. Seizures have been reported in 1.5% of patients, particularly with high doses. Patients with allergies to other β-lactams may experience hypersensitivity reactions, although the incidence of immediate hypersensitivity is low (<1%) [7].

The emergence of carbapenem resistance

Since 2000, the number of bacterial species carrying ESBL genes has increased, and community-acquired Escherichia coli isolates with the ability to produce ESBLs that hydrolyze almost all β-lactam agents, except for carbapenems, have been reported worldwide [28,29]. As a result, the clinical use of carbapenems has increased. This in turn caused an increase in the number of clinical bacterial isolates producing β-lactamases that have the ability to hydrolyze carbapenems, known as carbapenemases [30]. Thus, the overuse of carbapenems has led to the emergence of carbapenem resistance, which is the ability of bacteria to grow and survive in the presence of clinically relevant carbapenem concentrations [31].

Mechanism of carbapenem resistance

Resistance to carbapenems may be attributed to three major mechanisms: porin-mediated resistance to reduce uptake of carbapenems, efflux pumps, which pump the carbapenem outside the cells and enzyme-mediated resistance which is mediated via the acquisition of carbapenemase genes. The reduced uptake or increased efflux of antibiotics are usually associated with an overexpression of β-lactamases possessing weak affinities for carbapenems [32,33]. The nature of the resistance determinants can affect the dynamics of their spread [34].

Porin-mediated resistance

Bacteria can limit the entry of carbapenems into the periplasmic space where PBPs are located. This mechanism involves the modification of porin expression or alterations in the porin-encoding gene, leading to either complete loss or defects in the respective porin [35]. For example, the main mechanism of resistance to carbapenems in P. aeruginosa isolates is the downregulation of the gene encoding the orpd porin [36]. Likewise, the altered expression of ompk35 and ompk36 in Klebsiella pneumoniae was observed to cause a high resistance level to ertapenem [37].

Overproduction of efflux pumps

Efflux pumps are generally able to recognize numerous substrates, given that affinity is based on physiochemical properties (e.g., electric charge, aromatic or hydrophobic properties) instead of chemical structures. This explains the presence of MDR efflux pumps which can expel many structurally unrelated antimicrobials [38]. Gram-negative bacteria such as P. aeruginosa and Acinetobacter species are well known for their efflux-mediated β-lactam resistance [39]. The overexpression of efflux pumps active on carbapenems may lead to carbapenem resistance [10,40].

Enzyme-mediated resistance

In most cases, resistance is due to the production of β-lactamases capable of hydrolyzing carbapenems and other β-lactam antimicrobials, hence they are called carbapenemases. This resistance mechanism poses the greatest threat, as these enzymes can inactivate the majority of β-lactams and are encoded by genes carried on transposons, plasmids or other mobile genetic elements, which can be horizontally transferred to other bacterial species [10].

Based on their molecular structures, carbapenemases belong to three classes of β-lactamases; class A, B and D. Classes A and D possess a serine residue at the active site to facilitate ring opening, they are thus called serine β-lactamases (SBLs) [41]. Class B comprises metallo-β-lactamases (MBLs), the active site of which uses zinc ions to mediate bond hydrolysis [39]. β-lactamase inhibitors such as clavulanic acid, sulbactam and/or tazobactam can inhibit SBLs. On the other hand, MBLs are not affected by such inhibitors, but are inhibited by metal ion chelators, such as dipicolinic acid, EDTA or o-phenanthroline; all of which are not approved for clinical use [42].

Class A carbapenemases

Class A carbapenemases include K. pneumoniae carbapenemases (KPCs), imipenem-hydrolyzing β-lactamase (IMI), Guiana extended spectrum carbapenemase (GES), Serratia fonticola carbapenemase, Serratia marcescens enzyme and nonmetallo-carbapenemase-A [43]. KPCs have the ability to hydrolyze all β-lactams and strains carrying the bla_KPC gene are usually resistant to other antimicrobials, such as aminoglycosides, fluoroquinolones and trimethoprim-sulfamethoxazole, making them MDR. Thirteen KPC variants have been described so far [44]. The most frequently reported of which are KPC-2 and KPC-3 [45,46]. The bla_KPC genes are plasmid-encoded, and are thus prone to interspecies horizontal transmission [47].

Isolates that produce IMI might rarely be detected due to their unusual AMR profile, such isolates are usually resistant to imipenem, but show intermediate resistance to ertapenem and sensitive toward extended-spectrum cephalosporins. Moreover, the bla_IMI gene is not included in the panel of genes targeted by commercially available molecular diagnostic kits. IMI-1 carbapenemases are chromosomally encoded and are thus considered clinically irrelevant [48].

Several genotypes of the bla_GES gene (coding for GES β-lactamase) contain a point mutation (G493A), which causes the incorporation of serine instead of glycine. The resulting mutant enzyme displays carbapenemase activity. Reports of GES carbapenemases are rare but increasing steadily [49]. As the case of KPC, GES carbapenemases are plasmid-borne [28,50].

Class B carbapenemases

In 1966, Sabath and Abraham discovered the first class B enzyme BCII, the Bacillus cereus MBL [51]. By 1989, only four MBLs were discovered, and were all chromosomally encoded, consequently they were deemed clinically unimportant. Yet, in 1991, the plasmid-encoded imipenem-resistant Pseudomonas-type carbapenemases (IMP) was discovered in P. aeruginosa in Japan, which revived the clinical interest in this class of enzymes [52]. Today, MBLs are mainly plasmid-encoded, facilitating their transmission among microbial pathogens [53]. They are also the most molecularly diverse class of carbapenemases and can inactivate the majority of β-lactams, with the exception of monobactams [54]. New Delhi MBL (NDM) is an MBL that can confer resistance to enteric pathogens, such as K. pneumoniae and E. coli, making them resistant to β-lactams, including carbapenems [55] but not aztreonam [56]. Verona integron-encoded MBL (VIM) was first described in Verona, Italy, from a P. aeruginosa isolate in 1999. The hydrolytic profile of VIM is like other members of this class, hydrolyzing most β-lactams except for aztreonam [53]. It is worth mentioning that bacteria co-expressing SBLs and MBLs are usually able to hydrolyze the clinically relevant monobactam, aztreonam [57]. Moreover, two MBLs, including German imipenemase and Sao Paulo MBL have been detected in the clinical isolates of S. marcescens and P. aeruginosa, respectively [58,59].

Class D carbapenemases

These include the oxacillinase (OXA) enzymes, which have the ability to efficiently hydrolyze oxacillin, for which they were named [60]. The OXA-2 β-lactamase was the first discovered class D enzyme [61]. The carbapenem-hydrolyzing OXA-48 enzyme has high hydrolysis activity toward penicillins and low hydrolysis activity toward carbapenems [33]. It is also not affected by β-lactamase inhibitors, which is why this enzyme has recently gained attention [62]. Other OXA β-lactamases as OXA-23, OXA-24/40 and OXA-58, are frequently found in species of Acinetobacter but have a relatively weak carbapenemase activity [30]. One of the greatest threats posed by this class of enzymes is the lack of inhibitors for them [60].

History & epidemiology of the most clinically encountered carbapenemases

Klebsiella pneumoniae carbapenemases

In 1996, the first KPC enzyme (KPC-2) was isolated and characterized in North Carolina, USA, from a K. pneumoniae clinical isolate [63,64]. Since then, KPC-producing K. pneumoniae isolates have widely disseminated across the US [65]. KPC-producers’ outbreaks have since been reported worldwide. In 2007, a hospital in Crete, Greece, reported an outbreak caused by KPC-2-producing K. pneumoniae isolates. The outbreak affected 22 hospitalized patients who had no history of travelling to KPC-producer infested areas [66]. The first KPC identified in P. aeruginosa (outside the Enterobacteriaceae family) was in Medellin, Colombia [67]. In 2008, an outbreak of KPC-3-producing K. pneumoniae was reported in Columbia, causing the death of 20 out of 32 (62.5%) affected patients. In 2009, another outbreak was reported in Italy, also caused by a KPC-3-producing K. pneumoniae isolate, which affected 16 intensive care unit patients [68]. In 2010, KPC-2-producing Citrobacter freundii isolates were reported in Madrid, Spain [69]. A study on carbapenem-resistant Enterobacteriaceae (CRE) isolates obtained during the period between 2013 and 2016 at a health system in Northern California reported that 38.7% of the tested isolates harbored carbapenemase genes, 20.8% of which carried the bla_KPC gene [70].

New Delhi MBL

In 2008, an NDM-producing K. pneumoniae isolate was identified in a Swedish patient of Indian origin who had recently been to New Delhi, India, where he acquired a urinary tract infection caused by a carbapenem-resistant K. pneumoniae isolate [55]. Later on, the SENTRY Antimicrobial Surveillance Program reported that NDM-producing Enterobacteriaceae (Enterobacter cloacae, K. pneumoniae and E. coli strains) have been present in Indian hospitals since 2006 and possibly even earlier [71]. NDM-producers have also been isolated from drinking and seepage water (i.e., pools of water in the streets) samples attained in New Delhi, which poses a major health threat to inhabitants relying on public sanitation facilities and tap water [72]. Since their discovery, NDM carbapenemases have been reported to be found in Enterobacteriaceae isolates worldwide, mostly from patients with travel history to India [73]. A study published in 2019 reported that NDM-producing K. pneumoniae isolates were isolated from hospitalized patients at a hospital in Tehran, Iran [74]. A study conducted in the United Arab Emirates, published in 2019, was concerned with CRE isolates carrying plasmids of the incompatibility group X type 3 (IncX3), these isolates were collected in the period between 2009 and 2014. Thirty isolates were found to harbor either bla_NDM-1, bla_NDM-4, bla_NDM-5, bla_NDM-7, bla_OXA-181 or bla_KPC-2 carbapenemase genes on IncX3 plasmids. Phylogenetic analysis suggested that the detected carbapenemase genes did not evolve locally in the United Arab Emirates, but rather occurred due to international travel [75].

Oxacillinase

In 2001, OXA-48 was first identified in a K. pneumoniae isolate from Istanbul, Turkey [76]. Five years later, the first outbreak of infections caused by OXA-48-producing K. pneumoniae was reported in Istanbul [77]. In 2010, an outbreak caused by OXA-48-producing K. pneumonia isolates was reported in France [78]. Another outbreak was also reported in Belgium [79]. Hospital outbreaks have been reported in The Netherlands, as well as Russia [62]. Sporadic cases of OXA-48-producing isolates have been reported in Senegal [80], Lebanon [81], Tunisia [82] and Egypt [20].

A recent study conducted in Egypt on carbapenem-resistant Gram-negative bacteria recovered from febrile neutropenic pediatric cancer patients during the period from October 2014 to December 2016, revealed that bla_OXA-48 was the most prevalent carbapenemase gene (58.62%), followed by bla_NDM (27.58%), bla_VIM-3 (10.3%) and bla_KPC-2 (6.89%) [83]. Another study conducted in Iran on carbapenem-resistant K. pneumoniae isolates from clinical samples of blood, urine and sputum, obtained from October 2015 to September 2016, revealed that bla_OXA-48 was the most prevalent carbapenemase gene (72%), followed by bla_NDM (31%) [74]. A study published in 2018 on carbapenem-resistant Acinetobacter baumannii isolates from 14 Colombian hospitals detected bla_OXA-23--like and bla_OXA-51_-.like-genes occurring simultaneously in 97.5% of the tested isolates [84].

Detection of CRE

Infections caused by CRE pose a major health threat since they are usually resistant to β-lactams, aminoglycosides and fluoroquinolones [85]. CRE are now causing treatment failure in both community-acquired and nosocomial infections [86]. Consequently, there is a serious need for rapid and accurate detection of carbapenemase-producing isolates. According to the CLSI guidelines, isolates of Enterobacteriaceae are suspected of being carbapenemase producers when the minimum inhibitory concentrations (MICs) of meropenem or imipenem are 2–4 μg/ml or MIC of ertapenem is 2 μg/ml [87].

The modified Hodge test

Although this test is cheap and very simple to perform, a high frequency of false-positive results was observed with isolates that produce ESBLs associated with porin loss or alterations [88,89]. False negative results were also observed with NDM-1 carbapenemases [89]. For these reasons, this test was removed from CLSI guidelines in 2018.

Carba NP test

The Carba NP test is a colorimetric microtube assay used to test for carbapenemase production in Enterobacteriaceae and P. aeruginosa. This test has a high level of sensitivity and specificity (>90% each) in detecting KPC, NDM, VIM, IMP and S. marcescens enzyme-type carbapenemases, but low sensitivity (11%) for detecting OXA-48 carbapenemases [87]. The Carba NP test was reported to detect carbapenemase production even in imipenem-susceptible carbapenemase-producing Enterobacteriaceae (CPE) [90]. A ready-to-use version (RAPIDEC^® Carba NP test) for routine use in laboratories has been recently made commercially available [91].

Modified carbapenem inactivation method

The modified carbapenem inactivation method (mCIM) test is used to detect carbapenemase-production in Enterobacteriaceae and P. aeruginosa. Contrary to Carba NP, which requires special reagents that are not routinely used in clinical laboratories, the mCIM test uses readily available reagents and media. Its procedure is simple, and the results can be easily interpreted. Moreover, an EDTA-mCIM can be used along with mCIM to differentiate serine carbapenemases from MBLs in Enterobacteriaceae [87].

Bioluminescence-based carbapenem susceptibility detection assay

This method was recently developed by Vincent van Almsick et al. It permits the identification of carbapenemase-producing A. baumannii, carbapenemase-producing-CRE and noncarbapenemase-producing-CRE in just 2.5 h from culture media with a sensitivity and specificity of 99 and 98%, respectively [92].

Immunochromatographic assays

A number of immunochromatographic assays have been developed to enable the detection of VIM, NDM, KPC and OXA-48 carbapenemases in 5 min directly from cultured bacterial colonies [93]. These assays are based on monoclonal antibodies that were generated by immunization in mice [94].

Matrix-assisted laser desorption-ionization time-of-flight mass spectrometry

In this method, freshly prepared bacterial cultures are mixed with carbapenem solutions such as ertapenem or meropenem and incubated for 2–4 h at 35–37°C. Afterwards the mixture is centrifuged and the mass spectrometry technique is used to measure the supernatant. In case of carbapenemase hydrolysis, the degradation products and sodium salt of the carbapenem molecule are visible in spectra [95,96].

Spectrophotometric assay

This method is performed by preparing a bacterial crude extract, usually by sonication, which is then added to a buffered imipenem solution. UV spectroscopy is used to measure the hydrolysis of the β-lactam ring [96,97].

Molecular assay

A number of molecular techniques for the detection of carbapenemase genes are currently available. These assays can determine not only the exact identity of the carbapenemase, but also the absence or presence of the enzyme(s) [89]. These assays include conventional simplex and multiple PCR assays, using the appropriate primers for each gene (Table 1). The hyplex SuperBug ID test system (bioTRADING, Mijdrecht, Netherlands) is one of the available PCR assays [98]. There are also loop-mediated isothermal amplification-based systems such as the eazyplex^® SuperBug CRE system (AmplexDiagnostics GmbH, Gars, Germany) [99]. Several real-time PCR assays are also available such as the NucliSENS EasyQ KPC assay (bioMérieux, Marcy-l'Étoile, France), the Check-Direct CPE assay (Check-points, Wageningen, The Netherlands) and the Xpert Carba-R assay (Cepheid Inc., CA, USA) [100–102].

Table 1. **Primers sequences, PCR product sizes and annealing temperatures of carbapenemase genes.**
Gene	Forward primer (5′ → 3′)	Reverse primer (5′ → 3′)	Expected product size (bp)	Ta (°C)	Ref.
bla_KPC	TGTCACTGTATCGCCGTC	CTCAGTGCTCTACAGAAAACC	900	58	[63,103,104]
	CGTCTAGTTCTGCTGTCTTG	CTTGTCATCCTTGTTAGGCG	798	52	[28,105]
	CTGTCTTGTCTCTCATGGCC	CCTCGCTGTGCTTGTCATCC	796	53	[47]
bla_IMP	CTACCGCAGCAGAGTCTTTG	AACCAGTTTTGCCTTACCAT	587	55	[104,106]
	GAAGGCGTTTATGTTCATAC	GTACGTTTCAAGAGTGATGC	587	60	[103]
	GGAATAGAGTGGCTTAAYTC^†	TCGGTTTAAYAAAACAACCACC^†	232	52	[28,105]
bla_VIM	TCTACATGACCGCGTCTGTC	TGTGCTTTGACAACGTTCGC	748	50	[107]
	GTTTGGTCGCATATCGCAAC	AATGCGCAGCACCAGGATAG	389	60	[103]
	AGTGGTGAGTATCCGACAG	ATGAAAGTGCGTGGAGAC	261	52	[104,108]
	GATGGTGTTTGGTCGCATA	CGAATGCGCAGCACCAG	390	52	[28,105]
bla_NDM	GGTTTGGCGATCTGGTTTTC	CGGAATGGCTCATCACGAT	621	50	[105,109]
	GCAGCTTGTCGGCCATGCGGGC	GGTCGCGAAGCTGAGCACCGCAT	782	60	[103]
	CAGCGCAGCTTGTCG	TCGCGAAGCTGAGCA	784	52	[110]
bla_OXA-48	GCGTGGTTAAGGATGAACAC	CATCAAGTTCAACCCAACCG	438	52	[28,103,105]
	TTGGTGGCATCGATTATCGG	GAGCACTTCTTTTGTGATGGC	743	56	[111,112]

bla_KPC. bla_IMP. bla_VIM. bla_NDM and bla_OXA-48 genes code for KPC, IMP, VIM, NDM and OXA-48 carbapenemases, respectively.

†Y stands for C or T.

IMP: Imipenemase or imipenem-resistant Pseudomonas-type carbapenemases, class B; KPC: Klebsiella pneumoniae carbapenemases; NDM: New Delhi metallo-β-lactamase; Ta: Annealing temperature; VIM: Veronese imipenemase.

In a recent study conducted by Mentasti et al. in 2019, an assay targeting IMP, NDM, VIM, KPC and OXA-48-like carbapenemases was designed and validated for the rapid detection of the mentioned carbapenemases from Enterobacteriales and Gram-negative nonfermenter bacteria by real-time PCR and melt-curve analysis [113].

DNA microarray assays are currently available for use as well, including but not limited to the Check MDR CT103 XL kit (Check-points) [114].

Moreover, construction and evaluation of a microbiological positive process internal control for PCR-based examination of food samples for Listeria monocytogenes and Salmonella enterica was carried out where an assay for detecting a 76 bp fragment of the green fluorescent protein (GFP) from Aequorea victoria was carried out [115].

Treatment options for infections caused by carbapenem-resistant bacteria

Glycopeptides are still considered as good alternatives to carbapenems in cases where the infection is caused by carbapenem-resistant Gram-positive bacteria. However, carbapenem-resistant Gram-negative bacteria, especially CRE, have limited treatment options since they usually carry resistance determinants to β-lactams, aminoglycosides and fluoroquinolones [116,117]. In such cases, treatment options should be discussed with microbiologists since some CREs are sensitive to amikacin. Older antimicrobials that were rarely administered in the past due to efficacy and toxicity concerns may be considered. These may include fosfomycin, polymyxins (colistin) and the newer tigecycline [85,118].

Dual-carbapenem combination therapy may be considered for infections caused by pandrug-resistant bacteria; however, data on this treatment are somewhat limited [119,120].

Some studies suggest in vitro synergistic effects of several antibiotic combinations against carbapenem-resistant Gram-negative bacteria. These synergistic combinations include colistin with rifampicin [121,122], carbapenem with sulbactam [122], colistin with carbapenem [123] and carbapenem with an aminoglycoside [124]. However, in vivo studies showed unexpected results. The colistin/meropenem combination in vivo did not result in better outcomes compared with colistin monotherapy in regard to either clinical response or development of resistance [125,126].

Plazomicin is a newly marketed next-generation aminoglycoside [31]. In a study conducted by Rodríguez-Avial et al., Plazomicin was used at subinhibitory concentrations in combination with fosfomycin, meropenem and colistin. Results showed a synergistic bactericidal effect against carbapenemase-producing K. pneumoniae isolates [127]. Novel β-lactamase inhibitors, such as vaborbactam, avibactam and relebactam, are capable of counteracting the effect of KPC and ESBLs [128]. Lately, new β-lactam/β-lactamase inhibitor combinations, namely meropenem/vaborbactam, ceftazidime/avibactam and imipenem/cilastatin/relebactam were approved by the US FDA (MD, USA) for the treatment of infections caused by CRE [118,129,130].

A number of novel antimicrobial agents are being developed for the treatment of infections caused by resistant bacteria, cefiderocol (S-649266) is one of them. This siderophore cephalosporin reaches the periplasmic space by active transport and binds to PBP3 of Gram-negative bacteria, which eventually causes the inhibition of bacterial cell wall synthesis. Cefiderocol was reported to be stable to carbapenemases and other ESBLs [131–133]. Eravacycline is a new tetracycline with a broad spectrum of activity that includes CRE [134].

Antimicrobial stewardship

Antimicrobial stewardship is a term referring to programs and coordinated interventions aiming at regulating the use of antimicrobials [135]. The main purpose of antimicrobial stewardship is to attain the best clinical outcomes regarding antimicrobial use, while reducing adverse effects and toxicity in order to limit the selective pressure on bacteria, which leads to the emergence of AMR [136]. Antimicrobial stewardship plans should be developed and implemented by all healthcare facilities following the Infectious Disease Society of America and Society for Healthcare Epidemiology of America (VA, USA) guidelines [137] and careful monitoring of these interventions is highly recommended [136].

Conclusion

Carbapenems represent an important class of antibiotics that are still reserved for infections caused by MDR microorganisms. However, the emergence of carbapenem resistance has dramatically increased worldwide and therefore poses a serious public health threat. Several mechanisms including reduced uptake, active efflux of carbapenems, as well as inactivation via carbapenemases are involved in the bacterial resistance to carbapenems. A number of molecular assays for the detection of carbapenemase genes are currently available including conventional simplex PCR, multiplex PCR, real-time PCR and loop-mediated isothermal amplification-based systems. Glycopeptides, Fosfomycin, polymyxins (colistin), tigecycline, plazomicin and new members of tetracyclines such as eravacycline are the last treatment options for the treatment of infections caused by carbapenem-resistant bacteria. Therefore, the use of these last resort antibiotics should be controlled to avoid antibiotic misuse or overuse, and their use should be limited to the intensive care units in hospitals and only prescribed under strict medical supervision.

Future perspective

The collection of epidemiological data is important for taking appropriate and yet affordable measures against CRE and CPE. Guidelines should be developed and implemented in all healthcare facilities to enable epidemiological data collection and rapid reporting of any outbreaks so that appropriate measures could be taken as soon as possible. Antibiotic stewardship programs should be implemented for antibiotic prescription and use, as well as for the control and monitoring of infections caused by the clinically relevant pathogens in healthcare facilities. Culture and sensitivity, as well as MIC determination, for carbapenem-resistant pathogens should be performed before initiating antimicrobial therapy to determine the appropriate dose and duration of treatment, and thereby avoid unnecessary prescription and overuse of carbapenems.

Continued research is urgently needed to determine the most appropriate treatment for serious CRE infections. Alternative approaches for treating such infections should be considered, such as phage therapy or quenching of quorum sensing. Antibiotic combinations that show promising in vitro effects should be investigated through clinical trials to determine their efficacy in vivo. As for antimicrobial development, guidelines should be implemented for premarketing research on potential mechanisms of resistance at an early stage of new antimicrobial development. Finally, strict measures must be taken to prevent dispensing of antimicrobials without a prescription to avoid the misuse or overuse of such agents.

Executive summary

The emergence of carbapenem resistance has dramatically increased worldwide and resulted in treatment failure of community-acquired and nosocomial infections.
Reduced uptake, active efflux and production of carbapenemases are the major resistance mechanisms to carbapenems.
Conventional simplex, multiplex, real-time PCR and loop-mediated isothermal amplification–based systems are currently available techniques for the detection of carbapenemase genes.
Glycopeptides, fosfomycin and polymyxins (colistin), plazomicin, tigecycline and new members of tetracyclines such as eravacycline are still effective for the treatment of infections caused by carbapenem-resistant pathogens.

Author contributions

AA Elshamy reviewed the literature and drafted the manuscript. KM Aboshanab reviewed and edited the manuscript. All authors read and approved the manuscript.

Financial & competing interests disclosure

The authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.

No writing assistance was utilized in the production of this manuscript.

Open access

This work is licensed under the Creative Commons Attribution 4.0 License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

Papers of special note have been highlighted as: • of interest; •• of considerable interest

References

1. Antimicrobial Resistance in Developing Countries. Sosa A de J Byarugaba DK Amabile C Hsueh PR Kariuki S Okeke IN (Eds). Springer, NY, USA (2010).
Google Scholar
2. Sugden R , Kelly R , Davies S . Combatting antimicrobial resistance globally. Nat. Microbiol. 1(10), 16187 (2016).
CASGoogle Scholar
3. WHO. Global antimicrobial resistance surveillance system (GLASS) report: early implementation 2017–2018 (2018). www.apps.who.int/iris/bitstream/handle/10665/279656/9789241515061-eng.pdf?ua=1
Google Scholar
4. Holmes AH , Moore LSP , Sundsfjord A et al. Understanding the mechanisms and drivers of antimicrobial resistance. Lancet 387(10014), 176–187 (2016).
CASGoogle Scholar
5. Tenover FC . Mechanisms of antimicrobial resistance in bacteria. Am. J. Infect. Control 34(5), S3–S10 (2006).
Google Scholar
6. Walsh C . Molecular mechanisms that confer antibacterial drug resistance. Nature 406(6797), 775–781 (2000).
CASGoogle Scholar
7. Brunton LL , Knollmann BC , Hilal-Dandan R . Goodman & Gilman's the pharmacological basis of therapeutics (13th Edition). Shanahan JF Lebowitz H (Ed.). McGraw Hill Medical, NY, USA (2018).
Google Scholar
8. Walsh C . Antibiotics: actions, origins, resistance. ASM Press, Washington DC, USA (2003).
Google Scholar
9. El-Gamal MI , Brahim I , Hisham N , Aladdin R , Mohammed H , Bahaaeldin A . Recent updates of carbapenem antibiotics. Eur. J. Med. Chem. 131, 185–195 (2017).
CASGoogle Scholar
10. Meletis G . Carbapenem resistance: overview of the problem and future perspectives. Ther. Adv. Infect. Dis. 3(1), 15–21 (2016).
CASGoogle Scholar
11. Birnbaum J , Kahan FM , Kropp H , Macdonald JS . Carbapenems, a new class of beta-lactam antibiotics: discovery and development of imipenem/cilastatin. Am. J. Med. 78(6), 3–21 (1985).
CASGoogle Scholar
12. Kahan JS , Kahan FM , Goegelman R et al. Thienamycin, a new beta-lactam antibiotic. I. Discovery, taxonomy, isolation and physical properties. J. Antibiot. (Tokyo) 32(1), 1–12 (1979).
CASGoogle Scholar
13. Lee Y , Bradley N . Overview and insights into Carbapenem allergy. Pharmacy 7(3), 110–116 (2019).
CASGoogle Scholar
14. Foye WO , Lemke TL , Williams DA . Foye's Principles of Medicinal Chemistry (7th Edition). Wolters Kluwer Health/Lippincott Williams & Wilkins, PA, USA (2013).
Google Scholar
15. Grayson ML . Kucers' the Use of Antibiotics: a Clinical Review of Antibacterial, Antifungal, Antiparasitic and Antiviral Drugs (6th Edition). CRC Press, FL, USA (2012). • Details information on carbapenems including structures, spectrum of activity, mechanism of drug action, mechanisms of resistance to such agents, mode of drug administration and dose–drug interactions and adverse effects.
Google Scholar
16. Buckley MM , Brogden RN , Barradell LB , Goa KL . Imipenem/Cilastatin. Drugs 44(3), 408–444 (1992).
CASGoogle Scholar
17. Fischer J , Ganellin CR . Analogue-based drug discovery (6th Edition). Wiley-VCH, Weinheim, Germany (2006).
Google Scholar
18. Nordmann P , Dortet L , Poirel L . Carbapenem resistance in Enterobacteriaceae: here is the storm ! Trends Mol. Med. 18(5), 263–272 (2012).
CASGoogle Scholar
19. Ellappan K , Belgode Narasimha H , Kumar S . Coexistence of multidrug resistance mechanisms and virulence genes in carbapenem-resistant Pseudomonas aeruginosa strains from a tertiary care hospital in South India. J. Glob. Antimicrob. Resist. 12, 37–43 (2018).
Google Scholar
20. Elshamy A , Aboshanab K , Yassien M , Hassouna N . Prevalence of carbapenem resistance among multidrug-resistant Gram-negative uropathogens. Arch. Pharm. Sci. Ain Shams Univ. 2(2), 70–77 (2018).
Google Scholar
21. Zhanel GG , Wiebe R , Dilay L et al. Comparative review of the carbapenems. Drugs 67(7), 1027–1052 (2007).
CASGoogle Scholar
22. Solomkin JS , Mazuski JE , Bradley JS et al. Diagnosis and management of complicated intra-abdominal infection in adults and children: guidelines by the Surgical Infection Society and the Infectious Diseases Society of America. Clin. Infect. Dis. 50(2), 133–164 (2010).
Google Scholar
23. Papp-Wallace KM , Endimiani A , Taracila MA , Bonomo RA . Carbapenems: past, present, and future. Antimicrob. Agents Chemother. 55(11), 4943–4960 (2011).
CASGoogle Scholar
24. Fisher JF , Meroueh SO , Mobashery S . Bacterial resistance to β-Lactam antibiotics: compelling opportunism, compelling opportunity. Chem. Rev. 105(2), 395–424 (2005).
CASGoogle Scholar
25. Kapoor G , Saigal S , Elongavan A . Action and resistance mechanisms of antibiotics: a guide for clinicians. J. Anaesthesiol. Clin. Pharmacol. 33(3), 300–305 (2017).
CASGoogle Scholar
26. Heijenoort Jv . Formation of the glycan chains in the synthesis of bacterial peptidoglycan. Glycobiology 11, 25R–36R (2001).
Google Scholar
27. Scholar EM , Pratt WB . The Antimicrobial Drugs (2nd Edition). Oxford University Press, NY, USA (2000).
Google Scholar
28. Nordmann P , Naas T , Poirel L . Global spread of carbapenemase-producing Enterobacteriaceae . Emerg. Infect. Dis. 17(10), 1791–1798 (2011).
CASGoogle Scholar
29. Blair JMA , Webber MA , Baylay AJ , Ogbolu DO , Piddock LJV . Molecular mechanisms of antibiotic resistance. Nat. Rev. Microbiol. 13(1), 42–51 (2015).
CASGoogle Scholar
30. Tzouvelekis LS , Markogiannakis A , Psichogiou M , Tassios PT , Daikos GL . Carbapenemases in Klebsiella pneumoniae and other Enterobacteriaceae: an evolving crisis of global dimensions. Clin. Microbiol. Rev. 25(4), 682–707 (2012).
CASGoogle Scholar
31. Durante-Mangoni E , Andini R , Zampino R . Management of carbapenem-resistant Enterobacteriaceae infections. Clin. Microbiol. Infect. 25(8), 943–950 (2019).
CASGoogle Scholar
32. Yang D , Guo Y , Zhang Z . Combined porin loss and extended spectrum β-lactamase production is associated with an increasing imipenem minimal inhibitory concentration in clinical Klebsiella pneumoniae strains. Curr. Microbiol. 58(4), 366–370 (2009).
CASGoogle Scholar
33. Logan LK , Weinstein RA . The epidemiology of carbapenem-resistant Enterobacteriaceae: the impact and evolution of a global menace. J. Infect. Dis. 215(Suppl. 1), S28–S36 (2017).
CASGoogle Scholar
34. Little ML , Qin X , Zerr DM , Weissman SJ . Molecular diversity in mechanisms of carbapenem resistance in paediatric Enterobacteriaceae . Int. J. Antimicrob. Agents 39(1), 52–57 (2012).
CASGoogle Scholar
35. Doumith M , Ellington MJ , Livermore DM , Woodford N . Molecular mechanisms disrupting porin expression in ertapenem-resistant Klebsiella and Enterobacter spp. clinical isolates from the UK. J. Antimicrob. Chemother. 63(4), 659–667 (2009).
CASGoogle Scholar
36. Farra A , Islam S , Strålfors A , Sörberg M , Wretlind B . Role of outer membrane protein OprD and penicillin-binding proteins in resistance of Pseudomonas aeruginosa to imipenem and meropenem. Int. J. Antimicrob. Agents 31(5), 427–433 (2008).
CASGoogle Scholar
37. Garcia-Fernandez A , Miriagou V , Papagiannitsis CC et al. An ertapenem-resistant extended-spectrum-β-lactamase-producing Klebsiella pneumoniae clone carries a novel OmpK36 porin variant. Antimicrob. Agents Chemother. 54(10), 4178–4184 (2010).
CASGoogle Scholar
38. Lomovskaya O , Zgurskaya HI , Totrov M , Watkins WJ . Waltzing transporters and “the dance macabre” between humans and bacteria. Nat. Rev. Drug Discov. 6(1), 56–65 (2007).
CASGoogle Scholar
39. King DT , Sobhanifar S , Strynadka NCJ . The mechanisms of resistance to β-lactam antibiotics. In: Handbook of Antimicrobial Resistance. Berghuis A Matlashewski G Wainberg MA Sheppard D (Eds). Springer New York, NY, USA, 177–201 (2017).
Google Scholar
40. Meletis G , Exindari M , Vavatsi N , Sofianou D , Diza E . Mechanisms responsible for the emergence of carbapenem resistance in Pseudomonas aeruginosa . Hippokratia 16(4), 303–307 (2012).
CASGoogle Scholar
41. Jacoby GA , Munoz-Price LS . The new β-lactamases. N. Engl. J. Med. 352(4), 380–391 (2005).
CASGoogle Scholar
42. Dougherty TJ , Pucci MJ . Antibiotic discovery and development. Springer Science and Business Media, NY, USA (2012).
Google Scholar
43. Patel G , Bonomo RA . “Stormy waters ahead”: global emergence of carbapenemases. Front. Microbiol. 4, 48–64 (2013).
Google Scholar
44. Djahmi N , Dunyach-Remy C , Pantel A , Dekhil M , Sotto A , Lavigne J-P . Epidemiology of carbapenemase-producing Enterobacteriaceae and Acinetobacter baumannii in mediterranean countries. BioMed Res. Int. 2014, 1–11 (2014).
Google Scholar
45. Nordmann P , Cuzon G , Naas T . The real threat of Klebsiella pneumoniae carbapenemase-producing bacteria. Lancet Infect. Dis. 9(4), 228–236 (2009).
CASGoogle Scholar
46. Pfeifer Y , Cullik A , Witte W . Resistance to cephalosporins and carbapenems in Gram-negative bacterial pathogens. Int. J. Med. Microbiol. 300(6), 371–379 (2010).
CASGoogle Scholar
47. Cuzon G , Naas T , Truong H et al. Worldwide diversity of Klebsiella pneumoniae that produce beta-lactamase bla_KPC-2 gene. Emerg. Infect. Dis. 16(9), 1349–1356 (2010).
CASGoogle Scholar
48. Miltgen G , Bonnin RA , Avril C et al. Outbreak of IMI-1 carbapenemase-producing colistin-resistant Enterobacter cloacae on the French island of Mayotte (Indian Ocean). Int. J. Antimicrob. Agents 52(3), 416–420 (2018).
CASGoogle Scholar
49. Takano C , Seki M , Kim DW et al. Development of a novel loop-mediated isothermal amplification method to detect guiana extended-spectrum (GES) β-lactamase genes in Pseudomonas aeruginosa . Front. Microbiol. 10, 25–31 (2019).
Google Scholar
50. Queenan AM , Bush K . Carbapenemases: the versatile β-lactamases. Clin. Microbiol. Rev. 20(3), 440–458 (2007).
CASGoogle Scholar
51. Sabath LD , Abraham EP . Zinc as a Cofactor for Cephalosporinase from Bacillus cereus 569. Biochem. J. 98(1), 11C–13C (1966).
CASGoogle Scholar
52. Watanabe M , Iyobe S , Inoue M , Mitsuhashi S . Transferable imipenem resistance in Pseudomonas aeruginosa . Antimicrob. Agents Chemother. 35(1), 147–151 (1991).
CASGoogle Scholar
53. Walsh TR , Toleman MA , Poirel L , Nordmann P . Metallo-β -lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18(2), 306–325 (2005).
CASGoogle Scholar
54. Walsh TR . Emerging carbapenemases: a global perspective. Int. J. Antimicrob. Agents 36, S8–S14 (2010).
CASGoogle Scholar
55. Yong D , Toleman MA , Giske CG et al. Characterization of a new metallo-β-lactamase gene, bla_NDM-1. and a novel erythromycin esterase gene carried on a unique genetic structure in Klebsiella pneumoniae sequence Type 14 from India. Antimicrob. Agents Chemother. 53(12), 5046–5054 (2009).
CASGoogle Scholar
56. Doi Y , Paterson D . Carbapenemase-producing Enterobacteriaceae . Semin. Respir. Crit. Care Med. 36(01), 074–084 (2015).
Google Scholar
57. Nordmann P , Poirel L , Walsh TR , Livermore DM . The emerging NDM carbapenemases. Trends Microbiol. 19(12), 588–595 (2011).
CASGoogle Scholar
58. Rieber H , Frontzek A , Pfeifer Y . Emergence of metallo-β-lactamase GIM-1 in a clinical isolate of Serratia marcescens . Antimicrob. Agents Chemother. 56(9), 4945–4947 (2012).
CASGoogle Scholar
59. Hong DJ , Bae IK , Jang I-H , Jeong SH , Kang H-K , Lee K . Epidemiology and characteristics of metallo-β-lactamase-producing Pseudomonas aeruginosa . Infect. Chemother. 47(2), 81 (2015).
CASGoogle Scholar
60. Majiduddin FK , Materon IC , Palzkill TG . Molecular analysis of beta-lactamase structure and function. Int. J. Med. Microbiol. 292(2), 127–137 (2002).
CASGoogle Scholar
61. Dale JW , Godwin D , Mossakowska D , Stephenson P , Wall S . Sequence of the OXA2 β-lactamase: comparison with other penicillin-reactive enzymes. FEBS Lett. 191(1), 39–44 (1985).
CASGoogle Scholar
62. Poirel L , Potron A , Nordmann P . OXA-48-like carbapenemases: the phantom menace. J. Antimicrob. Chemother. 67(7), 1597–1606 (2012).
CASGoogle Scholar
63. Yigit H , Queenan AM , Anderson GJ et al. Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae . Antimicrob. Agents Chemother. 45(4), 1151–1161 (2001).
CASGoogle Scholar
64. Yigit H , Queenan AM , Anderson GJ et al. Novel carbapenem-hydrolyzing β-lactamase, KPC-1, from a carbapenem-resistant strain of Klebsiella pneumoniae . Antimicrob. Agents Chemother. 52(2), 809–809 (2008).
CASGoogle Scholar
65. Kitchel B , Rasheed JK , Patel JB et al. Molecular epidemiology of KPC-producing Klebsiella pneumoniae isolates in the United States: clonal expansion of multilocus sequence Type 258. Antimicrob. Agents Chemother. 53(8), 3365–3370 (2009).
CASGoogle Scholar
66. Maltezou HC , Giakkoupi P , Maragos A et al. Outbreak of infections due to KPC-2-producing Klebsiella pneumoniae in a hospital in Crete (Greece). J. Infect. 58(3), 213–219 (2009).
CASGoogle Scholar
67. Villegas MV , Lolans K , Correa A et al. First identification of Pseudomonas aeruginosa isolates producing a KPC-Type carbapenem-hydrolyzing β-lactamase. Antimicrob. Agents Chemother. 51(4), 1553–1555 (2007).
CASGoogle Scholar
68. Agodi A , Voulgari E , Barchitta M et al. Containment of an outbreak of KPC-3-producing Klebsiella pneumoniae in Italy. J. Clin. Microbiol. 49(11), 3986–3989 (2011).
Google Scholar
69. Gomez-Gil MR , Pano-Pardo JR , Romero-Gomez MP et al. Detection of KPC-2-producing Citrobacter freundii isolates in Spain. J. Antimicrob. Chemother. 65(12), 2695–2697 (2010).
CASGoogle Scholar
70. Senchyna F , Gaur RL , Sandlund J et al. Diversity of resistance mechanisms in carbapenem-resistant Enterobacteriaceae at a healthcare system in Northern California, from 2013 to 2016. Diagn. Microbiol. Infect. Dis. 93(3), 250–257 (2019).
CASGoogle Scholar
71. Castanheira M , Deshpande LM , Mathai D , Bell JM , Jones RN , Mendes RE . Early dissemination of NDM-1- and OXA-181-producing Enterobacteriaceae in Indian hospitals: report from the SENTRY Antimicrobial Surveillance Program, 2006–2007. Antimicrob. Agents Chemother. 55(3), 1274–1278 (2011).
CASGoogle Scholar
72. Walsh TR , Weeks J , Livermore DM , Toleman MA . Dissemination of NDM-1 positive bacteria in the New Delhi environment and its implications for human health: an environmental point prevalence study. Lancet Infect. Dis. 11(5), 355–362 (2011).
Google Scholar
73. Aung MS , San N , Maw WW et al. Prevalence of extended-spectrum Beta-lactamase and carbapenemase genes in clinical isolates of Escherichia coli in Myanmar: Dominance of bla_NDM-5 and Emergence of bla_OXA-181. Microb. Drug Resist. 24(9), 1333–1344 (2018).
CASGoogle Scholar
74. Jafari Z , Harati AA , Haeili M et al. Molecular epidemiology and drug resistance pattern of carbapenem-resistant Klebsiella pneumoniae isolates from Iran. Microb. Drug Resist. 25(3), 336–343 (2019).
CASGoogle Scholar
75. Mouftah SF , Pál T , Darwish D et al. Epidemic IncX3 plasmids spreading carbapenemase genes in the United Arab Emirates and worldwide. Infect. Drug Resist. 12, 1729–1742 (2019).
CASGoogle Scholar
76. Poirel L , Heritier C , Tolun V , Nordmann P . Emergence of oxacillinase-mediated resistance to imipenem in Klebsiella pneumoniae . Antimicrob. Agents Chemother. 48(1), 15–22 (2004).
CASGoogle Scholar
77. Carrer A , Poirel L , Eraksoy H , Cagatay AA , Badur S , Nordmann P . Spread of OXA-48-positive carbapenem-resistant Klebsiella pneumoniae isolates in Istanbul, Turkey. Antimicrob. Agents Chemother. 52(8), 2950–2954 (2008).
CASGoogle Scholar
78. Cuzon G , Ouanich J , Gondret R , Naas T , Nordmann P . Outbreak of OXA-48-positive carbapenem-resistant Klebsiella pneumoniae isolates in France. Antimicrob. Agents Chemother. 55(5), 2420–2423 (2011).
CASGoogle Scholar
79. Glupczynski Y , Huang T-D , Bouchahrouf W et al. Rapid emergence and spread of OXA-48-producing carbapenem-resistant Enterobacteriaceae isolates in Belgian hospitals. Int. J. Antimicrob. Agents 39(2), 168–172 (2012).
CASGoogle Scholar
80. Moquet O , Bouchiat C , Kinana A et al. Class D OXA-48 carbapenemase in multidrug-resistant Enterobacteria, Senegal. Emerg. Infect. Dis. 17(1), 143–144 (2011).
Google Scholar
81. Matar GM , Dandache I , Carrër A et al. Spread of OXA-48-mediated resistance to carbapenems in Lebanese Klebsiella pneumoniae and Escherichia coli that produce extended spectrum β-lactamase. Ann. Trop. Med. Parasitol. 104(3), 271–274 (2010).
CASGoogle Scholar
82. Lahlaoui H , Poirel L , Barguellil F , Moussa MB , Nordmann P . Carbapenem-hydrolyzing class D β-lactamase OXA-48 in Klebsiella pneumoniae isolates from Tunisia. Eur. J. Clin. Microbiol. Infect. Dis. 31(6), 937–939 (2012).
CASGoogle Scholar
83. Kamel NA , El-tayeb WN , El-Ansary MR , Mansour MT , Aboshanab KM . Phenotypic screening and molecular characterization of carbapenemase-producing Gram-negative bacilli recovered from febrile neutropenic pediatric cancer patients in Egypt. PLoS ONE 13(8), e0202119 (2018).
Google Scholar
84. Correa A , del C , ampo R , Escandón-Vargas K et al. Distinct genetic diversity of carbapenem-resistant Acinetobacter baumannii from Colombian hospitals. Microb. Drug Resist. 24(1), 48–54 (2018).
CASGoogle Scholar
85. Morrill HJ , Pogue JM , Kaye KS , LaPlante KL . Treatment options for carbapenem-resistant Enterobacteriaceae infections. Open Forum Infect. Dis. 2(2), ofv050 (2015).
Google Scholar
86. Gautier G , Guillard T , Podac B , Bercot B , Vernet-Garnier V , de Champs C . Detection of different classes of carbapenemases: adaptation and assessment of a phenotypic method applied to Enterobacteriaceae, Pseudomonas aeruginosa and Acinetobacter baumannii, and proposal of a new algorithm. J. Microbiol. Methods 147, 26–35 (2018).
CASGoogle Scholar
87. Weinstein MP . Performance Standards for Antimicrobial Susceptibility Testing. CLSI supplement M100 (28th Edition). Clinical and Laboratory Standards Institute, PA, USA (2018).
Google Scholar
88. Seah C , Low DE , Patel SN , Melano RG . Comparative evaluation of a chromogenic Agar medium, the Modified Hodge test, and a battery of Meropenem-inhibitor discs for detection of carbapenemase activity in Enterobacteriaceae . J. Clin. Microbiol. 49(5), 1965–1969 (2011).
Google Scholar
89. Patel JB . Performance standards for antimicrobial susceptibility testing. CLSI supplement M100 (27th Edition). Clinical and Laboratory Standards Institute, PA, USA (2017).
Google Scholar
90. Segawa T , Matsui M , Suzuki M et al. Utilizing the Carba NP test as an indicator of expression level of carbapenemase genes in Enterobacteriaceae . J. Microbiol. Methods 133, 35–39 (2017).
CASGoogle Scholar
91. Poirel L , Nordmann P . Rapidec carba NP test for rapid detection of carbapenemase producers. J. Clin. Microbiol. 53(9), 3003–3008 (2015).
CASGoogle Scholar
92. van Almsick V , Ghebremedhin B , Pfennigwerth N , Ahmad-Nejad P . Rapid detection of carbapenemase-producing Acinetobacter baumannii and carbapenem-resistant Enterobacteriaceae using a bioluminescence-based phenotypic method. J. Microbiol. Methods 147, 20–25 (2018).
CASGoogle Scholar
93. Wareham DW , Phee LM , Abdul Momin MHF . Direct detection of carbapenem resistance determinants in clinical specimens using immunochromatographic lateral flow devices. J. Antimicrob. Chemother. 73(7), 1997–1998 (2018).
CASGoogle Scholar
94. Glupczynski Y , Evrard S , Ote I et al. Evaluation of two new commercial immunochromatographic assays for the rapid detection of OXA-48 and KPC carbapenemases from cultured bacteria. J. Antimicrob. Chemother. 71(5), 1217–1222 (2016).
Google Scholar
95. Neonakis IK , Spandidos DA . Detection of carbapenemase producers by matrix-assisted laser desorption-ionization time-of-flight mass spectrometry (MALDI-TOF MS). Eur. J. Clin. Microbiol. Infect. Dis. 38(10), 1795–1801 (2019).
CASGoogle Scholar
96. Hrabák J , Chudáčkova E , Papagiannitsis CC . Detection of carbapenemases in Enterobacteriaceae: a challenge for diagnostic microbiological laboratories. Clin. Microbiol. Infect. 20(9), 839–853 (2014).
CASGoogle Scholar
97. Bernabeu S , Poirel L , Nordmann P . Spectrophotometry-based detection of carbapenemase producers among Enterobacteriaceae . Diagn. Microbiol. Infect. Dis. 74(1), 88–90 (2012).
CASGoogle Scholar
98. Kaase M , Szabados F , Wassill L , Gatermann SG . Detection of carbapenemases in Enterobacteriaceae by a commercial multiplex PCR. J. Clin. Microbiol. 50(9), 3115–3118 (2012).
CASGoogle Scholar
99. Garcia-Fernandez S , Morosini M-I , Marco F et al. Evaluation of the eazyplex^® SuperBug CRE system for rapid detection of carbapenemases and ESBLs in clinical Enterobacteriaceae isolates recovered at two Spanish hospitals. J. Antimicrob. Chemother. 70, 1047–1050 (2014).
Google Scholar
100. McEwan AS , Derome A , Meunier D , Burns PJ , Woodford N , Dodgson AR . Evaluation of the NucliSENS EasyQ KPC assay for detection of Klebsiella pneumoniae Carbapenemase-Producing Enterobacteriaceae . J. Clin. Microbiol. 51(6), 1948–1950 (2013).
CASGoogle Scholar
101. Nijhuis R , Samuelsen Ø , Savelkoul P , van Zwet A . Evaluation of a new real-time PCR assay (Check-Direct CPE) for rapid detection of KPC, OXA-48, VIM, and NDM carbapenemases using spiked rectal swabs. Diagn. Microbiol. Infect. Dis. 77(4), 316–320 (2013).
CASGoogle Scholar
102. Traczewski MM , Carretto E , Canton R et al. Multicenter evaluation of the Xpert Carba-R Assay for detection of carbapenemase genes in Gram-negative isolates. J. Clin. Microbiol. 56(8), e00272–18 (2018).
CASGoogle Scholar
103. Doyle D , Peirano G , Lascols C , Lloyd T , Church DL , Pitout JDD . Laboratory detection of Enterobacteriaceae that produce carbapenemases. J. Clin. Microbiol. 50(12), 3877–3880 (2012).
CASGoogle Scholar
104. Woodford N , Tierno PM , Young K et al. Outbreak of Klebsiella pneumoniae producing a new carbapenem- hydrolyzing class A -Lactamase, KPC-3, in a New York Medical Center. Antimicrob. Agents Chemother. 48(12), 4793–4799 (2004).
CASGoogle Scholar
105. Poirel L , Walsh TR , Cuvillier V , Nordmann P . Multiplex PCR for detection of acquired carbapenemase genes. Diagn. Microbiol. Infect. Dis. 70(1), 119–123 (2011).
CASGoogle Scholar
106. Senda K , Arakawa Y , Ichiyama S et al. PCR detection of metallo-β-lactamase gene (bla_IMP) in Gram-negative rods resistant to broad-spectrum β-lactams. J. Clin. Microbiol. 34(12), 2909–2913 (1996).
CASGoogle Scholar
107. Poirel L , Naas T , Nicolas D et al. Characterization of VIM-2, a carbapenem-hydrolyzing metallo-β-lactamase and its plasmid-and integron-borne gene from a Pseudomonas aeruginosa clinical isolate in France. Antimicrob. Agents Chemother. 44(4), 891–897 (2000).
CASGoogle Scholar
108. Tsakris A , Pournaras S , Woodford N et al. Outbreak of infections caused by Pseudomonas aeruginosa Producing VIM-1 carbapenemase in Greece. 38(3), 1290–1292 (2000).
Google Scholar
109. Nordmann P , Poirel L , Carrer A , Toleman MA , Walsh TR . How to detect NDM-1 producers. J. Clin. Microbiol. 49(2), 718–721 (2011).
Google Scholar
110. Peirano G , Ahmed-Bentley J , Woodford N , Pitout JD . New Delhi metallo-β-lactamase from traveler returning to Canada. Emerg. Infect. Dis. 17(2), 242–244 (2011).
CASGoogle Scholar
111. Poirel L , Bonnin RA , Nordmann P . Genetic features of the widespread plasmid coding for the carbapenemase OXA-48. Antimicrob. Agents Chemother. 56(1), 559–562 (2012).
CASGoogle Scholar
112. Aktaş Z , Bal Kayacan Ç , Schneider I , Can B , Midilli K , Bauernfeind A . Carbapenem-hydrolyzing oxacillinase, OXA-48, persists in Klebsiella pneumoniae in Istanbul, Turkey. Chemotherapy 54(2), 101–106 (2008).
CASGoogle Scholar
113. Mentasti M , Prime K , Sands K , Khan S , Wootton M . Rapid detection of IMP, NDM, VIM, KPC and OXA-48-like carbapenemases from Enterobacteriales and Gram-negative non-fermenter bacteria by real-time PCR and melt-curve analysis. Eur. J. Clin. Microbiol. Infect. Dis. 38(11), 2029–2036 (2019). •• Explains the methodology for detecting several clinically relevant carbapenemases via real time PCR.
CASGoogle Scholar
114. Cunningham SA , Vasoo S , Patel R . Evaluation of the check-points check MDR CT103 and CT103 XL microarray kits by use of preparatory rapid cell lysis. J. Clin. Microbiol. 54(5), 1368–1371 (2016).
CASGoogle Scholar
115. Murphy NM , McLauchlin J , Ohai C , Grant KA . Construction and evaluation of a microbiological positive process internal control for PCR-based examination of food samples for Listeria monocytogenes and Salmonella enterica . Int. J. Food Microbiol. 120(1–2), 110–119 (2007).
CASGoogle Scholar
116. Gupta K , Bhadelia N . Management of urinary tract infections from multidrug-resistant organisms. Infect. Dis. Clin. North Am. 28(1), 49–59 (2014).
Google Scholar
117. Alizadeh N , Rezaee MA , Kafil HS et al. Detection of carbapenem-resistant Enterobacteriaceae by chromogenic screening media. J. Microbiol. Methods 153, 40–44 (2018).
CASGoogle Scholar
118. Peri AM , Doi Y , Potoski BA , Harris PNA , Paterson DL , Righi E . Antimicrobial treatment challenges in the era of carbapenem resistance. Diagn. Microbiol. Infect. Dis. 94(4), 413–425 (2019).
CASGoogle Scholar
119. Giamarellou H , Galani L , Baziaka F , Karaiskos I . Effectiveness of a double-carbapenem regimen for infections in humans due to carbapenemase-producing pandrug-resistant Klebsiella pneumoniae . Antimicrob. Agents Chemother. 57(5), 2388–2390 (2013).
CASGoogle Scholar
120. Ceccarelli G , Falcone M , Giordano A et al. Successful ertapenem–doripenem combination treatment of bacteremic ventilator-associated pneumonia due to colistin-resistant KPC-producing Klebsiella pneumoniae . Antimicrob. Agents Chemother. 57(6), 2900–2901 (2013).
CASGoogle Scholar
121. Lagerbäck P , Khine WWT , Giske CG , Tängdén T . Evaluation of antibacterial activities of colistin, rifampicin and meropenem combinations against NDM-1-producing Klebsiella pneumoniae in 24 h in vitro time–kill experiments. J. Antimicrob. Chemother. 71(8), 2321–2325 (2016).
CASGoogle Scholar
122. Song JY , Kee SY , Hwang IS et al. In vitro activities of carbapenem/sulbactam combination, colistin, colistin/rifampicin combination and tigecycline against carbapenem-resistant Acinetobacter baumannii . J. Antimicrob. Chemother. 60(2), 317–322 (2007).
CASGoogle Scholar
123. Deris ZZ , Yu HH , Davis K et al. The combination of colistin and doripenem is synergistic against Klebsiella pneumoniae at multiple inocula and suppresses colistin resistance in an In Vitro Pharmacokinetic/Pharmacodynamic Model. Antimicrob. Agents Chemother. 56(10), 5103–5112 (2012).
CASGoogle Scholar
124. Yadav R , Landersdorfer CB , Nation RL , Boyce JD , Bulitta JB . Novel approach to optimize synergistic carbapenem-aminoglycoside combinations against carbapenem-resistant Acinetobacter baumannii . Antimicrob. Agents Chemother. 59(4), 2286–2298 (2015).
CASGoogle Scholar
125. Paul M , Daikos GL , Durante-Mangoni E et al. Colistin alone versus colistin plus meropenem for treatment of severe infections caused by carbapenem-resistant Gram-negative bacteria: an open-label, randomised controlled trial. Lancet Infect. Dis. 18(4), 391–400 (2018). • Investigates the in vivo effect of the promising antimicrobial combination (colistin with meropenem) which showed synergistic effect in vitro in previous studies against carbapenem-resistant Gram-negative bacteria when compared with colistin monotherapy. In vivo results show no significant difference regarding clinical response or development of resistance.
CASGoogle Scholar
126. Falagas ME , Rafailidis PI , Kasiakou SK , Hatzopoulou P , Michalopoulos A . Effectiveness and nephrotoxicity of colistin monotherapy vs colistin–meropenem combination therapy for multidrug-resistant Gram-negative bacterial infections. Clin. Microbiol. Infect. 12(12), 1227–1230 (2006). • Investigates the in vivo effect of the promising antimicrobial combination (colistin with meropenem) which showed synergistic effect in vitro in previous studies against carbapenem-resistant Gram-negative bacteria when compared with colistin monotherapy. In vivo results show no significant difference regarding clinical response or development of resistance.
CASGoogle Scholar
127. Rodríguez-Avial I , Pena I , Picazo JJ , Rodríguez-Avial C , Culebras E . In vitro activity of the next-generation aminoglycoside plazomicin alone and in combination with colistin, meropenem, fosfomycin or tigecycline against carbapenemase-producing Enterobacteriaceae strains . Int. J. Antimicrob. Agents 46(6), 616–621 (2015).
CASGoogle Scholar
128. Toussaint KA , Gallagher JC . β-lactam/β-lactamase inhibitor combinations: from then to now. Ann. Pharmacother. 49(1), 86–98 (2015).
Google Scholar
129. Gibson B . A brief review of a new antibiotic: meropenem-vaborbactam. Sr. Care Pharm. 34(3), 187–191 (2019).
Google Scholar
130. Smibert O , Satlin MJ , Nellore A , Peleg AY . Carbapenem-resistant Enterobacteriaceae in solid organ transplantation: management principles. Curr. Infect. Dis. Rep. 21(7), 26–37 (2019).
Google Scholar
131. Falagas ME , Skalidis T , Vardakas KZ , Legakis NJ . on behalf of the Hellenic Cefiderocol Study Group. Activity of cefiderocol (S-649266) against carbapenem-resistant Gram-negative bacteria collected from inpatients in Greek hospitals. J. Antimicrob. Chemother. 72(6), 1704–1708 (2017).
CASGoogle Scholar
132. Kohira N , West J , Ito A et al. In vitro antimicrobial activity of a siderophore cephalosporin, S-649266, against Enterobacteriaceae clinical isolates, including carbapenem-resistant strains . Antimicrob. Agents Chemother. 60(2), 729–734 (2016).
CASGoogle Scholar
133. Ito-Horiyama T , Ishii Y , Ito A et al. Stability of novel siderophore cephalosporin S-649266 against clinically relevant carbapenemases. Antimicrob. Agents Chemother. 60(7), 4384–4386 (2016).
Google Scholar
134. Bassetti M , Righi E . Eravacycline for the treatment of intra-abdominal infections. Expert Opin. Investig. Drugs 23(11), 1575–1584 (2014).
CASGoogle Scholar
135. Fishman N . Antimicrobial stewardship. Am. J. Infect. Control 34(5), S55–S63 (2006).
Google Scholar
136. Fishman N . Society for Healthcare Epidemiology of America, Infectious Diseases Society of America, Pediatric Infectious Diseases Society. Policy statement on antimicrobial stewardship by the Society for Healthcare Epidemiology of America (SHEA), the Infectious Diseases Society of America (IDSA), and the Pediatric Infectious Diseases Society (PIDS). Infect. Control Hosp. Epidemiol. 33(4), 322–327 (2012).
Google Scholar
137. Dellit TH , Owens RC , McGowan JE et al. Infectious Diseases Society of America and the Society for Healthcare Epidemiology of America guidelines for developing an institutional program to enhance antimicrobial stewardship. Clin. Infect. Dis. 44(2), 159–177 (2007).
Google Scholar

Vol. 6, No. 3

Metrics

History

Received 28 August 2019

Accepted 22 October 2019

Published online 27 January 2020

Published in print March 2020

Information

Keywords

Author contributions

AA Elshamy reviewed the literature and drafted the manuscript. KM Aboshanab reviewed and edited the manuscript. All authors read and approved the manuscript.

Financial & competing interests disclosure

No writing assistance was utilized in the production of this manuscript.

Open access

This work is licensed under the Creative Commons Attribution 4.0 License. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/

PDF download